pAAV-U6-hSyn::mCherry.3xFLAG-WPRE
(Plasmid #120392)

• Purpose: (Empty Backbone) pAAV plasmid with BspQI sites for insertion of target specific shRNAs in frame of the murine U6 promoter and co expressing mCherry.3XFLAG under the hSyn promoter
• Depositing Lab: Florian Freudenberg
• Publication: Grunewald et al J Atten Disord. 2019 Jan 9:1087054718822129. doi: 10.1177/1087054718822129.

Backbone

• Vector backbone: pAAV
• Backbone size (bp): 4000
• Vector type: AAV
• Promoter: U6
• Tag / Fusion Protein:
  • mCherry.3XFLAG (C terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: GCCAACTCCATCACTAGGGG
• 3′ sequencing primer: ATGCGCAATTTGGGGAATGG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The original backbone was published in Candemir et al. Eur Neuropsychopharmacol. 2016 (PMID: 26861996)