pAcGFP-Jpx9C104T
(Plasmid
#120381)
-
PurposeReporter for RNA nuclear localization
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 120381 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAcGFP1-C1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameJPX
-
SpeciesH. sapiens (human)
-
Insert Size (bp)109
-
MutationC321T
-
GenBank IDNR_024582
-
Entrez GeneJPX (a.k.a. DCBALD06, ENOX, LINC00183, NCRNA00183)
- Promoter CMV
-
Tag
/ Fusion Protein
- AcGFP1 (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer acgagaagcgcgatcacatg
- 3′ sequencing primer gtgatgctattgctttatttgtaacc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAcGFP-Jpx9C104T was a gift from Igor Ulitsky (Addgene plasmid # 120381 ; http://n2t.net/addgene:120381 ; RRID:Addgene_120381) -
For your References section:
Sequences enriched in Alu repeats drive nuclear localization of long RNAs in human cells. Lubelsky Y, Ulitsky I. Nature. 2018 Mar 1;555(7694):107-111. doi: 10.1038/nature25757. Epub 2018 Jan 24. 10.1038/nature25757 PubMed 29466324