Skip to main content
Addgene

pAG180 SGCD 3'UTR mut
(Plasmid #12038)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 12038 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pIS2
  • Backbone manufacturer
    pIS2 derived from pRL-SV40 (Promega)
  • Backbone size w/o insert (bp) 3700
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    N13 3'UTR mut
  • Alt name
    SGCD
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    840
  • Mutation
    Mutations in microRNA recognition sites (seed matches): 1687-1692 and 2378-2383.
  • GenBank ID
    NM_000337
  • Entrez Gene
    SGCD (a.k.a. 35DAG, CMD1L, DAGD, LGMDR6, SG-delta, SGCDP, SGD)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer EBV rev primer (GTGGTTTGTCCAAACTCATC)
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

SGCD 3'UTR mutant in renilla luciferase reporter plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAG180 SGCD 3'UTR mut was a gift from David Bartel (Addgene plasmid # 12038 ; http://n2t.net/addgene:12038 ; RRID:Addgene_12038)

  • For your References section:

    The widespread impact of mammalian MicroRNAs on mRNA repression and evolution. Farh KK, Grimson A, Jan C, Lewis BP, Johnston WK, Lim LP, Burge CB, Bartel DP. Science. 2005 Dec 16. 310(5755):1817-21. 10.1126/science.1121158 PubMed 16308420
Related items:
Commonly requested with: