K8.1 Pr pGL4.16
(Plasmid
#120377)
-
PurposeFirefly luciferase reporter with KSHV K8.1 late gene promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 120377 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGL4.16[luc2CP/Hygro]
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 6020
- Total vector size (bp) 5998
-
Vector typeLuciferase
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameK8.1 Promoter
-
SpeciesKaposi's sarcoma-associated herpesvirus (HHV-8)
-
Insert Size (bp)23
- Promoter K8.1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ctagcaaaataggctgtccccagt (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
K8.1 Pr pGL4.16 was a gift from Britt Glaunsinger (Addgene plasmid # 120377 ; http://n2t.net/addgene:120377 ; RRID:Addgene_120377) -
For your References section:
The interaction between ORF18 and ORF30 is required for late gene expression in Kaposi's sarcoma-associated herpesvirus. Castaneda AF, Glaunsinger BA. J Virol. 2018 Oct 10. pii: JVI.01488-18. doi: 10.1128/JVI.01488-18. 10.1128/JVI.01488-18 PubMed 30305361