2xStrep-ORF34 pCDNA4
(Plasmid #120376)

• Purpose: Expresses KSHV ORF34 with Nterm 2xStrep tag in mammalian cells
• Depositing Lab: Britt Glaunsinger
• Publication: Castaneda et al J Virol. 2018 Oct 10. pii: JVI.01488-18. doi: 10.1128/JVI.01488-18.

Backbone

• Vector backbone: pcDNA4/TO
• Backbone size w/o insert (bp): 5168
• Total vector size (bp): 6083
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ORF34
• Species: Kaposi's sarcoma-associated herpesvirus (HHV-8)
• Insert Size (bp): 978
• GenBank ID: 4961504
• Entrez Gene: ORF34 (a.k.a. HHV8GK18_gp38)
• Promoter: CMV
• Tag / Fusion Protein:
  • 2xStrep Tag II (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (destroyed during cloning)
• 3′ cloning site: XbaI (destroyed during cloning)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: cctcgactgtgccttcta

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry