Akaluc-N1
(Plasmid #120371)

• Purpose: Akaluc luciferase mammalian expression in -N1 backbone
• Depositing Lab: Jordan Green
• Publication: Karlsson et al Adv Funct Mater. 2021 Apr 22;31(17). doi: 10.1002/adfm.202009768. Epub 2021 Feb 22.

Backbone

• Vector backbone: N1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 3928
• Total vector size (bp): 5673
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Can be grown at 30°C - just increase incubation time.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Akaluc (human optimized)
• Insert Size (bp): 1717
• Mutation: Human codon optimized
• GenBank ID: LC320664
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg
• 3′ sequencing primer: GATGAGTTTGGACAAACCAC

Resource Information

• Supplemental Documents:
  • akaluc-n1.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The akaluc gene was synthesized with human/murine codon optimization from the protein amino acid sequenced provided by Iwano et. al. Science 2018 as a more sensitive luciferase enzyme for live animal imaging in vivo with the substrate Akalumine-HCl. After synthesis, the gene was cloned and cloned into the eGFP-N1 (Addgene 6085-1) using restriction enzyme cloning.