Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

OA984-HA
(Plasmid #120362)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 120362 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBac[3xP3-DsRed]
  • Total vector size (bp) 9436
  • Vector type
    Unspecified

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    1C19 his-tagged single chain antibody
  • Insert Size (bp)
    717
  • Promoter AAEL010782 carboxypeptidase A (CPA) gene Promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGGTTGAGTTTTAAAAGTCTTGTTG
  • 3′ sequencing primer CAACAAGACTTTTAAAACTCAACCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    OA984-HA was a gift from Omar Akbari (Addgene plasmid # 120362 ; http://n2t.net/addgene:120362 ; RRID:Addgene_120362)
  • For your References section:

    Broad dengue neutralization in mosquitoes expressing an engineered antibody. Buchman A, Gamez S, Li M, Antoshechkin I, Li HH, Wang HW, Chen CH, Klein MJ, Duchemin JB, Crowe JE Jr, Paradkar PN, Akbari OS. PLoS Pathog. 2020 Jan 16;16(1):e1008103. doi: 10.1371/journal.ppat.1008103. eCollection 2020 Jan. 10.1371/journal.ppat.1008103 PubMed 31945137