PB-TAB-mOvol1
(Plasmid
#120360)
-
PurposepiggyBac transposon for dox-inducible expression of Ovol1 (with Bgeo; ie. LacZ / NeoR fusion).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 120360 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBluescript
-
Vector typeMammalian Expression ; piggyBac transposon
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOvol1
-
SpeciesM. musculus (mouse)
-
Entrez GeneOvol1 (a.k.a. BB147136, O, Ovo1, mo, movo1)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer GCATTCCTTTGGCGAGAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-TAB-mOvol1 was a gift from Knut Woltjen (Addgene plasmid # 120360 ; http://n2t.net/addgene:120360 ; RRID:Addgene_120360) -
For your References section:
OVOL1 Influences the Determination and Expansion of iPSC Reprogramming Intermediates. Kagawa H, Shimamoto R, Kim SI, Oceguera-Yanez F, Yamamoto T, Schroeder T, Woltjen K. Stem Cell Reports. 2018 Dec 28. pii: S2213-6711(18)30527-7. doi: 10.1016/j.stemcr.2018.12.008. 10.1016/j.stemcr.2018.12.008 PubMed 30639212