Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PB-TAC-OKMS-Cas9
(Plasmid #120353)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 120353 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PB-TAC-Cas9
  • Vector type
    Mammalian Expression, CRISPR ; piggyBac transposon

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    OKMS cassette
  • Species
    M. musculus (mouse)
  • Mutation
    Klf4 [10-483]

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site HpaI (not destroyed)
  • 5′ sequencing primer ATTGCATCGCATTGTCTGAG
  • 3′ sequencing primer ATGGGGAGAGTGAAGCAGAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please Note: Addgene NGS is unable to fully resolve the CAG promoter sequence. Please refer to depositor's provided sequence for this section of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB-TAC-OKMS-Cas9 was a gift from Knut Woltjen (Addgene plasmid # 120353 ; http://n2t.net/addgene:120353 ; RRID:Addgene_120353)
  • For your References section:

    OVOL1 Influences the Determination and Expansion of iPSC Reprogramming Intermediates. Kagawa H, Shimamoto R, Kim SI, Oceguera-Yanez F, Yamamoto T, Schroeder T, Woltjen K. Stem Cell Reports. 2018 Dec 28. pii: S2213-6711(18)30527-7. doi: 10.1016/j.stemcr.2018.12.008. 10.1016/j.stemcr.2018.12.008 PubMed 30639212