PB-TAC-OKMS-Cas9
(Plasmid
#120353)
-
PurposepiggyBac transposon for dox-inducible expression of the OKMS (Oct4, Klf4[10-483], c-Myc, Sox2) polycistronic reprogramming cassette (with mCherry). SpCas9 is constitutively expressed.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 120353 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePB-TAC-Cas9
-
Vector typeMammalian Expression, CRISPR ; piggyBac transposon
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOKMS cassette
-
SpeciesM. musculus (mouse)
-
MutationKlf4 [10-483]
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HpaI (not destroyed)
- 5′ sequencing primer ATTGCATCGCATTGTCTGAG
- 3′ sequencing primer ATGGGGAGAGTGAAGCAGAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please Note: Addgene NGS is unable to fully resolve the CAG promoter sequence. Please refer to depositor's provided sequence for this section of the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-TAC-OKMS-Cas9 was a gift from Knut Woltjen (Addgene plasmid # 120353 ; http://n2t.net/addgene:120353 ; RRID:Addgene_120353) -
For your References section:
OVOL1 Influences the Determination and Expansion of iPSC Reprogramming Intermediates. Kagawa H, Shimamoto R, Kim SI, Oceguera-Yanez F, Yamamoto T, Schroeder T, Woltjen K. Stem Cell Reports. 2018 Dec 28. pii: S2213-6711(18)30527-7. doi: 10.1016/j.stemcr.2018.12.008. 10.1016/j.stemcr.2018.12.008 PubMed 30639212