pGL4.23-MYC-e3
(Plasmid #120341)

• Purpose: pGL4.23-MYC with an enhancer cloned upstream of the MYC promoter.
• Depositing Lab: Eric Lander
• Publication: Fulco et al Science. 2016 Sep 29. pii: aag2445.

Backbone

• Vector backbone: pGL4.23-MYC
• Backbone size w/o insert (bp): 5322
• Total vector size (bp): 6793
• Modifications to backbone: pGL4.23-MYC is a modified version of the Promega pGL4.23 vector. Contains the MYC promoter in place of the minimal promoter and polyadenylation signals flanking the enhancer cloning site.
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: chr8:129056967-129058438 (hg19)
• Species: H. sapiens (human)
• Insert Size (bp): 1501
• Promoter: MYC

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CACTGCGGCTCCTCATCGCG
• 3′ sequencing primer: TCCGGTGCCCTGAATGAACT

Resource Information

• Supplemental Documents:
  • pGL4.23-MYC-e3.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry