Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p3x-Flag Gli3 37R3-2
(Plasmid #120305)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 120305 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFLAG-CMV-5.1
  • Backbone manufacturer
    Sigma
  • Backbone size w/o insert (bp) 6200
  • Total vector size (bp) 9732
  • Vector type
    Mammalian Expression, Synthetic Biology
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Intein 37R3-2, Gli3
  • Species
    Synthetic
  • Insert Size (bp)
    1239
  • Mutation
    Contains mutations as reported in 2011 Chemistry and Biology paper
  • Promoter CMV
  • Tag / Fusion Protein
    • 3X Flag

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GGCGGGACTATGGTTGCTGACTAAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p3x-Flag Gli3 37R3-2 was a gift from David Liu (Addgene plasmid # 120305 ; http://n2t.net/addgene:120305 ; RRID:Addgene_120305)
  • For your References section:

    Directed evolution of a small-molecule-triggered intein with improved splicing properties in mammalian cells. Peck SH, Chen I, Liu DR. Chem Biol. 2011 May 27;18(5):619-30. doi: 10.1016/j.chembiol.2011.02.014. 10.1016/j.chembiol.2011.02.014 PubMed 21609843