-
PurposeProduce human recombinant TGFB3 in DE3 cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 120288 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET-32a (+)
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5900
- Total vector size (bp) 6242
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)BL21 Star/DE3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTransforming Growth Factor-β3
-
Alt nameTGFB3
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)339
-
MutationCodon optimized for E. Coli production
- Promoter T7 promoter
-
Tags
/ Fusion Proteins
- 6x His (N terminal on insert)
- S-Tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer taatacgactcactatagg
- 3′ sequencing primer ctagcataaccccttggggcctctaaacgggtcttgaggggttttttg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byPrinted sequence service from SGI
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/685503v2 for BioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-32a(+)-TGFB3 was a gift from Paul Burridge (Addgene plasmid # 120288 ; http://n2t.net/addgene:120288 ; RRID:Addgene_120288) -
For your References section:
Negligible-Cost and Weekend-Free Chemically Defined Human iPSC Culture. Kuo HH, Gao X, DeKeyser JM, Fetterman KA, Pinheiro EA, Weddle CJ, Fonoudi H, Orman MV, Romero-Tejeda M, Jouni M, Blancard M, Magdy T, Epting CL, George AL Jr, Burridge PW. Stem Cell Reports. 2020 Jan 9. pii: S2213-6711(19)30446-1. doi: 10.1016/j.stemcr.2019.12.007. 10.1016/j.stemcr.2019.12.007 PubMed 31928950