Skip to main content
Addgene

pDYSCKO-ADE1
(Plasmid #120264)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 120264 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDYSCKO
  • Backbone size w/o insert (bp) 6467
  • Total vector size (bp) 6468
  • Modifications to backbone
    Stuffer replaced with guide targeting ADE1 (gRNA = GTCAATTACGAAGACTGAAC)
  • Vector type
    CRISPR, Synthetic Biology
  • Selectable markers
    URA3 ; Canavanine (after mutagenesis)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pDYSCKO cassette-ADE1 targeting guide
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1038
  • Promoter SNR52

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer GCGCCGCTACAGGGCGCGT
  • 3′ sequencing primer gctcgaaggctttaatttgc (preferable for Sanger)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

See Double Selection Enhances the Efficiency of Target-AID and Cas9-Based Genome Editing in Yeast. (PMID: 30097473) for detailed protocols for gRNA cloning and mutagenesis protocol.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDYSCKO-ADE1 was a gift from Christian Landry (Addgene plasmid # 120264 ; http://n2t.net/addgene:120264 ; RRID:Addgene_120264)
  • For your References section:

    Double Selection Enhances the Efficiency of Target-AID and Cas9-Based Genome Editing in Yeast. Despres PC, Dube AK, Nielly-Thibault L, Yachie N, Landry CR. G3 (Bethesda). 2018 Oct 3;8(10):3163-3171. doi: 10.1534/g3.118.200461. 10.1534/g3.118.200461 PubMed 30097473