pDYSCKO-ADE1
(Plasmid #120264)

• Purpose: pDYSCKO canavanine co-selection vector with a guide targeting the ADE1 locus
• Depositing Lab: Christian Landry
• Publication: Despres et al G3 (Bethesda). 2018 Oct 3;8(10):3163-3171. doi: 10.1534/g3.118.200461.

Backbone

• Vector backbone: pDYSCKO
• Backbone size w/o insert (bp): 6467
• Total vector size (bp): 6468
• Modifications to backbone: Stuffer replaced with guide targeting ADE1 (gRNA = GTCAATTACGAAGACTGAAC)
• Vector type: CRISPR, Synthetic Biology
• Selectable markers: URA3 ; Canavanine (after mutagenesis)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: pDYSCKO cassette-ADE1 targeting guide
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 1038
• Promoter: SNR52

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: GCGCCGCTACAGGGCGCGT
• 3′ sequencing primer: gctcgaaggctttaatttgc (preferable for Sanger)

Resource Information

• Supplemental Documents:
  • pdyscko-ade1.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

See Double Selection Enhances the Efficiency of Target-AID and Cas9-Based Genome Editing in Yeast. (PMID: 30097473) for detailed protocols for gRNA cloning and mutagenesis protocol.