Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDYSCKO
(Plasmid #120263)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 120263 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    p426
  • Backbone size w/o insert (bp) 5500
  • Total vector size (bp) 6500
  • Modifications to backbone
    Removed BsaI sites in URA3 and AmpR using silent mutations in the coding sequence.
  • Vector type
    CRISPR, Synthetic Biology
  • Selectable markers
    URA3 ; Canavanine (after mutagenesis)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DYSCKO cassette
  • gRNA/shRNA sequence
    ATAACGGAATCCAACTGGGC
  • Species
    S. cerevisiae (budding yeast)
  • Promoter SNR52

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCGCCGCTACAGGGCGCGT
  • 3′ sequencing primer caggaaacagctatgac
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The gRNA expression cassette is based on p426-SNR52p-gRNA.CAN1.Y-SUP4t (#43803) from the Church lab.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

See Double Selection Enhances the Efficiency of Target-AID and Cas9-Based Genome Editing in Yeast. (PMID: 30097473) for detailed protocols for gRNA cloning and mutagenesis protocol.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDYSCKO was a gift from Christian Landry (Addgene plasmid # 120263 ; http://n2t.net/addgene:120263 ; RRID:Addgene_120263)
  • For your References section:

    Double Selection Enhances the Efficiency of Target-AID and Cas9-Based Genome Editing in Yeast. Despres PC, Dube AK, Nielly-Thibault L, Yachie N, Landry CR. G3 (Bethesda). 2018 Oct 3;8(10):3163-3171. doi: 10.1534/g3.118.200461. 10.1534/g3.118.200461 PubMed 30097473