pDYSCKO
(Plasmid #120263)

• Purpose: Empty backbone for cloning any gRNA to be used with the canavanine co-selection system
• Depositing Lab: Christian Landry
• Publication: Despres et al G3 (Bethesda). 2018 Oct 3;8(10):3163-3171. doi: 10.1534/g3.118.200461.

Backbone

• Vector backbone: p426
• Backbone size w/o insert (bp): 5500
• Total vector size (bp): 6500
• Modifications to backbone: Removed BsaI sites in URA3 and AmpR using silent mutations in the coding sequence.
• Vector type: CRISPR, Synthetic Biology
• Selectable markers: URA3 ; Canavanine (after mutagenesis)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: DYSCKO cassette
• gRNA/shRNA sequence: ATAACGGAATCCAACTGGGC
• Species: S. cerevisiae (budding yeast)
• Promoter: SNR52

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCGCCGCTACAGGGCGCGT
• 3′ sequencing primer: caggaaacagctatgac

Resource Information

• Supplemental Documents:
  • pdyscko_can1.gb
• A portion of this plasmid was derived from a plasmid made by: The gRNA expression cassette is based on p426-SNR52p-gRNA.CAN1.Y-SUP4t (#43803) from the Church lab.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

See Double Selection Enhances the Efficiency of Target-AID and Cas9-Based Genome Editing in Yeast. (PMID: 30097473) for detailed protocols for gRNA cloning and mutagenesis protocol.