pCas9CR5-NG
(Plasmid #120228)

• Purpose: pCas9CR5 with mutations to change PAM site specificity to NG from Nishimasu et al.
• Depositing Lab: Christopher Reisch
• Publication: pCas9CR4 variants for increased targeting space (unpublished)

Backbone

• Vector backbone: pdCas9-bacteria
• Total vector size (bp): 6770
• Vector type: Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: SpCas9-NG
• Species: Synthetic; E. coli
• Insert Size (bp): 4200
• Mutation: Mutations R1335V/L1111R/D1135V/G1218R/E1219F/A1322R/T1337R
• Promoter: pTet

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: gttgacactctatcgttgat

Resource Information

• Supplemental Documents:
  • pCas9CR5-NG.gb
• A portion of this plasmid was derived from a plasmid made by: Addgene, Stanley Qi

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry