pCas9CR4-VQR
(Plasmid #120224)

• Purpose: pCas9CR4 with VQR mutations for changing PAM site specificity to NGAN or NGNG from Kleinstiver et al. 2015
• Depositing Lab: Christopher Reisch
• Publication: pCas9CR4 variants for increased targeting space (unpublished)

Backbone

• Vector backbone: pdCas9-bacteria
• Total vector size (bp): 6770
• Vector type: Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: SpCas9-VQR
• Species: Synthetic; E. coli
• Insert Size (bp): 4200
• Mutation: Mutations D1135V/R1335V/T1337R
• Promoter: pTet
• Tag / Fusion Protein:
  • ssrA (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: gttgacactctatcgttgat

Resource Information

• Supplemental Documents:
  • pCas9CR4-VQR.gb
• A portion of this plasmid was derived from a plasmid made by: Addgene, Stanley Qi

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The TetR protein coding sequence contains an F178S difference compared to the reference sequence that does not impact the function of the plasmid.