pCMV-GFP-CENPBpA
(Plasmid
#120162)
-
PurposeEGFP followed by the poly(A) site from human CENPB gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 120162 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV-GFP
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCENPB poly(A) site
-
SpeciesH. sapiens (human)
-
Insert Size (bp)254
- Promoter CMV
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CACTCTCGGCATGGACGAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-GFP-CENPBpA was a gift from David Bartel (Addgene plasmid # 120162 ; http://n2t.net/addgene:120162 ; RRID:Addgene_120162) -
For your References section:
Widespread Influence of 3'-End Structures on Mammalian mRNA Processing and Stability. Wu X, Bartel DP. Cell. 2017 May 18;169(5):905-917.e11. doi: 10.1016/j.cell.2017.04.036. 10.1016/j.cell.2017.04.036 PubMed 28525757