pMaCTag-Z08
(Plasmid #120051)

• Purpose: Template for C-terminal PCR tagging of mammalian genes (Zeocin selection) with mClover3
• Depositing Lab: Michael Knop
• Publication: Fueller et al J Cell Biol. 2020 Jun 1;219(6). pii: 151766. doi: 10.1083/jcb.201910210.

Backbone

• Vector backbone: pFA6a
• Backbone size w/o insert (bp): 2412
• Vector type: PCR Template
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mClover3
• Species: H. sapiens (human)
• Promoter: None
• Tag / Fusion Protein:
  • mClover3 (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: SpeI (not destroyed)
• 5′ sequencing primer: SP6
• 3′ sequencing primer: AAACCACAACTAGAATGCAGTG

Resource Information

• Supplemental Documents:
  • pMaCTag-Z08.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Template plasmid for C-terminal PCR tagging of mammalian genes. For M1 and M2 tagging oligo design please visit www.pcr-tagging.com Please visit https://www.biorxiv.org/content/early/2018/11/20/473876 for BioRxiv preprint