pMaCTag-P06
(Plasmid
#120017)
-
PurposeTemplate for C-terminal PCR tagging of mammalian genes (Puromycin selection) with sfGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 120017 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFA6a
- Backbone size w/o insert (bp) 2412
-
Vector typePCR Template
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesfGFP
-
SpeciesH. sapiens (human)
- Promoter None
-
Tag
/ Fusion Protein
- sfGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer SP6
- 3′ sequencing primer AAACCACAACTAGAATGCAGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Template plasmid for C-terminal PCR tagging of mammalian genes. For M1 and M2 tagging oligo design please visit www.pcr-tagging.com Please visit https://www.biorxiv.org/content/early/2018/11/20/473876 for BioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMaCTag-P06 was a gift from Michael Knop (Addgene plasmid # 120017 ; http://n2t.net/addgene:120017 ; RRID:Addgene_120017) -
For your References section:
CRISPR-Cas12a-assisted PCR tagging of mammalian genes. Fueller J, Herbst K, Meurer M, Gubicza K, Kurtulmus B, Knopf JD, Kirrmaier D, Buchmuller BC, Pereira G, Lemberg MK, Knop M. J Cell Biol. 2020 Jun 1;219(6). pii: 151766. doi: 10.1083/jcb.201910210. 10.1083/jcb.201910210 PubMed 32406907