Skip to main content
Addgene

pLV312.3
(Plasmid #119944)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119944 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    px601
  • Backbone manufacturer
    Feng Zhang lab
  • Backbone size w/o insert (bp) 4316
  • Total vector size (bp) 6516
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    C-Intein (Npu DnaE) - C-terminal (740)SaKKH-BE3
  • Alt name
    split BE3 (C-terminus)
  • Species
    R. norvegicus (rat); S. aureus
  • Insert Size (bp)
    3345
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (CMV for)
  • 3′ sequencing primer CCTCGACTGTGCCTTCTA (bGH rev)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

sgRNA targets Pahenu2 mutation

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV312.3 was a gift from Gerald Schwank (Addgene plasmid # 119944 ; http://n2t.net/addgene:119944 ; RRID:Addgene_119944)
  • For your References section:

    Treatment of a metabolic liver disease by in vivo genome base editing in adult mice. Villiger L, Grisch-Chan HM, Lindsay H, Ringnalda F, Pogliano CB, Allegri G, Fingerhut R, Haberle J, Matos J, Robinson MD, Thony B, Schwank G. Nat Med. 2018 Oct;24(10):1519-1525. doi: 10.1038/s41591-018-0209-1. Epub 2018 Oct 8. 10.1038/s41591-018-0209-1 [pii] PubMed 30297904