Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLV302
(Plasmid #119943)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119943 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    px601
  • Backbone manufacturer
    Feng Zhang lab
  • Backbone size w/o insert (bp) 3938
  • Total vector size (bp) 7283
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    N-terminal SaKKH-BE3(739) - N-Intein (Npu DnaE)
  • Alt name
    split BE3
  • Species
    R. norvegicus (rat); S. aureus
  • Insert Size (bp)
    3345
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (CMV for)
  • 3′ sequencing primer CCTCGACTGTGCCTTCTA (bGH rev)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV302 was a gift from Gerald Schwank (Addgene plasmid # 119943 ; http://n2t.net/addgene:119943 ; RRID:Addgene_119943)
  • For your References section:

    Treatment of a metabolic liver disease by in vivo genome base editing in adult mice. Villiger L, Grisch-Chan HM, Lindsay H, Ringnalda F, Pogliano CB, Allegri G, Fingerhut R, Haberle J, Matos J, Robinson MD, Thony B, Schwank G. Nat Med. 2018 Oct;24(10):1519-1525. doi: 10.1038/s41591-018-0209-1. Epub 2018 Oct 8. 10.1038/s41591-018-0209-1 [pii] PubMed 30297904