pLV302
(Plasmid #119943)

• Purpose: Expresses N-terminal Npu DnaE Intein-SaKKH-BE3 in mammalian cells
• Depositing Lab: Gerald Schwank
• Publication: Villiger et al Nat Med. 2018 Oct;24(10):1519-1525. doi: 10.1038/s41591-018-0209-1. Epub 2018 Oct 8.

Backbone

• Vector backbone: px601
• Backbone manufacturer: Feng Zhang lab
• Backbone size w/o insert (bp): 3938
• Total vector size (bp): 7283
• Vector type: Mammalian Expression, AAV, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: N-terminal SaKKH-BE3(739) - N-Intein (Npu DnaE)
• Alt name: split BE3
• Species: R. norvegicus (rat); S. aureus
• Insert Size (bp): 3345
• Promoter: CMV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG (CMV for)
• 3′ sequencing primer: CCTCGACTGTGCCTTCTA (bGH rev)

Resource Information

• Supplemental Documents:
  • pLV302 AAV-CMV-NLS-FLAG-APOBEC1-nSaKKH(739)-N-Intein-bGH(pA).gbk
• A portion of this plasmid was derived from a plasmid made by: SaKKH-BE3 insert was cloned from pJL-SaKKH-BE3 (David Liu lab)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry