BIC-Gag-CAS9
(Plasmid #119942)

• Purpose: encodes a GAG (F-MLV)-CAS9(sp) fusion. Allows the production of GAG-CAS9 Virus like particles from producer cells in association with over expressed gRNA(s) and appropriate envelopes.
• Depositing Labs: Philippe Mangeot, Théophile Ohlmann, Emiliano Ricci
• Publication: Mangeot et al Nat Commun. 2019 Jan 3;10(1):45. doi: 10.1038/s41467-018-07845-z.

Backbone

• Vector backbone: pCDNA3-like
• Total vector size (bp): 10745
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GAG FMLV fused to spCAS9
• Species: H. sapiens (human), M. musculus (mouse)
• Insert Size (bp): 5877
• Promoter: hCMV
• Tag / Fusion Protein:
  • FLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xho I (not destroyed)
• 3′ cloning site: BamHI. Not unique after cloning (not destroyed)
• 5′ sequencing primer: ACTACATCCTGGTCATCATCC
• 3′ sequencing primer: CCACCTTCTGATAGGCAGCC

Resource Information

• Supplemental Documents:
  • NANOBLADES PRODUCTION. BASICS
• A portion of this plasmid was derived from a plasmid made by: CAS9 was amplified from the lentiCRISPR plasmid (addgene #49535) from Zhang lab
• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2017/10/12/202010 for BioRxiv preprint. Note, there are some additional amino acids on the 3' end of the insert--depositor confirmed this is the version used in the paper and the plasmid should function as described.