Nme2Cas9_AAV
(Plasmid #119924)

• Purpose: All-in-one AAV plasmid expressing Nme2Cas9 with sgRNA cassette
• Depositing Lab: Erik Sontheimer
• Publication: Edraki et al Mol Cell. 2018 Dec 18. pii: S1097-2765(18)31033-5. doi: 10.1016/j.molcel.2018.12.003.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: AAV
• Backbone size w/o insert (bp): 2900
• Modifications to backbone: Contains U6-driven sgRNA cassette
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Nme2Cas9
• Alt name: Nme2Cas9c
• Species: N. meningitidis
• Insert Size (bp): 3300
• Promoter: U1a
• Tags / Fusion Proteins:
  • NLS-NLS (N terminal on insert)
  • NLS-3xHA-NLS

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GAGGATAAGCGGCCCGCAGCAA
• 3′ sequencing primer: TTTCTTTTTCTTGGCTTGACCTGCCTTC

Resource Information

• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry