-
PurposeCaHygB plasmids that facilitate genetic manipulations in the fungal pathogen
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 119922 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC18
- Backbone size w/o insert (bp) 6299
- Total vector size (bp) 7331
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCaHygB
-
Alt namehygromycin B resistance gene
-
SpeciesCandida albicnas
-
Insert Size (bp)1032
- Promoter TEF2
-
Tag
/ Fusion Protein
- CaHygB (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AatII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CTCGAGATGAAAAAACCAGAATTGACTGC
- 3′ sequencing primer GAGCTAAAGAATAAGGATCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byLuiz Basso, Charlie Gast
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYM70 was a gift from Brian Wong (Addgene plasmid # 119922 ; http://n2t.net/addgene:119922 ; RRID:Addgene_119922) -
For your References section:
Transformation of Candida albicans with a synthetic hygromycin B resistance gene. Basso LR Jr, Bartiss A, Mao Y, Gast CE, Coelho PS, Snyder M, Wong B. Yeast. 2010 Dec;27(12):1039-48. doi: 10.1002/yea.1813. Epub 2010 Aug 24. 10.1002/yea.1813 PubMed 20737428