pGEX-6p1-GST-ArcΔCTD
(Plasmid
#119878)
-
PurposeBacterial Expression construct for the production and purification of Arc missing C-terminal Domain
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 119878 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEX-6p1
- Backbone size w/o insert (bp) 4927
- Total vector size (bp) 5878
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsuse BL21 for protein production
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameActivity Regulated Cytoskeletal Protein
-
Alt nameArc, Arg3.1
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)951
-
MutationDeletion of nt 832-1110
-
GenBank IDZ46925.1
-
Entrez GeneArc (a.k.a. rg3.1)
- Promoter tac
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer TTTGCAGGGCTGGCAAGCCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX-6p1-GST-ArcΔCTD was a gift from Jason Shepherd (Addgene plasmid # 119878 ; http://n2t.net/addgene:119878 ; RRID:Addgene_119878) -
For your References section:
The Neuronal Gene Arc Encodes a Repurposed Retrotransposon Gag Protein that Mediates Intercellular RNA Transfer. Pastuzyn ED, Day CE, Kearns RB, Kyrke-Smith M, Taibi AV, McCormick J, Yoder N, Belnap DM, Erlendsson S, Morado DR, Briggs JAG, Feschotte C, Shepherd JD. Cell. 2018 Mar 22;173(1):275. doi: 10.1016/j.cell.2018.03.024. 10.1016/j.cell.2018.03.024 PubMed 29570995