Skip to main content
Addgene

pAAV-HDR-mEGFP-Actin
(Plasmid #119870)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119870 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    PX551
  • Backbone size w/o insert (bp) 2905
  • Total vector size (bp) 5992
  • Vector type
    Mouse Targeting, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    beta Actin
  • Alt name
    bActin
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Actb (a.k.a. Actx, E430023M04Rik, beta-actin)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ACTATCATATGCTTACCGTAAC
  • 3′ sequencing primer CGTCGCCGTCCAGCTCGACCA
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-HDR-mEGFP-Actin was a gift from Ryohei Yasuda (Addgene plasmid # 119870 ; http://n2t.net/addgene:119870 ; RRID:Addgene_119870)

  • For your References section:

    Virus-Mediated Genome Editing via Homology-Directed Repair in Mitotic and Postmitotic Cells in Mammalian Brain. Nishiyama J, Mikuni T, Yasuda R. Neuron. 2017 Oct 18. pii: S0896-6273(17)30933-9. doi: 10.1016/j.neuron.2017.10.004. 10.1016/j.neuron.2017.10.004 PubMed 29056297
Related items:
Commonly requested with: