His6_BcLOV4_Q355N_mCherry_BamUK
(Plasmid
#119762)
-
PurposeEncodes mCherry-tagged BcLOV4 permanently-"lit" mutant with Q355N mutation for expression in bacterial cell
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 119762 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneBamUK
- Backbone size w/o insert (bp) 4500
- Total vector size (bp) 6756
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFor protein production, transform into BL21 (DE3) and grow bacteria at 37 C until OD600 ~0.6-0.8 is reached. Following induction, grow at 18 C for 18-22 hours.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBcLOV4-Q355N_mCherry
-
SpeciesBotrytis cinerea
-
Insert Size (bp)2500
-
MutationMutated glutamine at position 355 to asparagine
- Promoter T7
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGG
- 3′ sequencing primer TAGTTATTGCTCAGCGGTGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
His6_BcLOV4_Q355N_mCherry_BamUK was a gift from Brian Chow (Addgene plasmid # 119762 ; http://n2t.net/addgene:119762 ; RRID:Addgene_119762) -
For your References section:
Synthetic cell-like membrane interfaces for probing dynamic protein-lipid interactions. Glantz ST, Berlew EE, Chow BY. Methods Enzymol. 2019;622:249-270. doi: 10.1016/bs.mie.2019.02.015. Epub 2019 Mar 23. 10.1016/bs.mie.2019.02.015 PubMed 31155055