His6_BcLOV4_Q355N_mCherry_BamUK
(Plasmid #119762)

• Purpose: Encodes mCherry-tagged BcLOV4 permanently-"lit" mutant with Q355N mutation for expression in bacterial cell
• Depositing Lab: Brian Chow
• Publication: Glantz et al Methods Enzymol. 2019;622:249-270. doi: 10.1016/bs.mie.2019.02.015. Epub 2019 Mar 23.

Backbone

• Vector backbone: BamUK
• Backbone size w/o insert (bp): 4500
• Total vector size (bp): 6756
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: For protein production, transform into BL21 (DE3) and grow bacteria at 37 C until OD600 ~0.6-0.8 is reached. Following induction, grow at 18 C for 18-22 hours.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: BcLOV4-Q355N_mCherry
• Species: Botrytis cinerea
• Insert Size (bp): 2500
• Mutation: Mutated glutamine at position 355 to asparagine
• Promoter: T7
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGG
• 3′ sequencing primer: TAGTTATTGCTCAGCGGTGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry