Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

His6_BcLOV4_C292A_mCherry_BamUK
(Plasmid #119761)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119761 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    BamUK
  • Backbone size w/o insert (bp) 4500
  • Total vector size (bp) 6756
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    For protein production, transform into BL21 (DE3) and grow bacteria at 37 C until OD600 ~0.6-0.8 is reached. Following induction, grow at 18 C for 18-22 hours.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    BcLOV4-C292A_mCherry
  • Species
    Botrytis cinerea
  • Insert Size (bp)
    2500
  • Mutation
    Mutated cysteine at position 292 to alanine
  • Promoter T7
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGG
  • 3′ sequencing primer TAGTTATTGCTCAGCGGTGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    His6_BcLOV4_C292A_mCherry_BamUK was a gift from Brian Chow (Addgene plasmid # 119761 ; http://n2t.net/addgene:119761 ; RRID:Addgene_119761)
  • For your References section:

    Synthetic cell-like membrane interfaces for probing dynamic protein-lipid interactions. Glantz ST, Berlew EE, Chow BY. Methods Enzymol. 2019;622:249-270. doi: 10.1016/bs.mie.2019.02.015. Epub 2019 Mar 23. 10.1016/bs.mie.2019.02.015 PubMed 31155055