-
Purpose(Empty Backbone) Allows cloning of gene of interest into bacterial expression vector with PreScission Protease cleavable N-terminal GST tag, and a retained N-terminal FLAG tag.
-
Depositing Labs
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 119759 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepGEX-6-P1
-
Backbone manufacturerAmersham
- Backbone size (bp) 5000
-
Modifications to backboneFLAG tag cloned into BamHI site of pGEX6P1, BamHI site only intact on 5' end
-
Vector typeBacterial Expression
- Promoter tac promoter
-
Tags
/ Fusion Proteins
- GST (N terminal on insert)
- FLAG (N terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer PGEX5' - GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer PGEX3' - CCGGGAGCTGCATGTGTCAGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX6P1-N-FLAG was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 119759 ; http://n2t.net/addgene:119759 ; RRID:Addgene_119759)
Map uploaded by the depositor.
