pGEX6P1-DEST-HA
(Plasmid #119751)

• Purpose: (Empty Backbone) Allows Gateway cloning of gene of interest into bacterial expression vector with PreScission Protease cleavable N-terminal GST tag, and a retained C-terminal HA tag.
• Depositing Labs: Andrew Jackson, Martin Reijns
• Publication: Bacterial expression plasmids for production of recombinant proteins with a PreScission Protease cleavable GST tag and additional small affinity tags (unpublished)

Backbone

• Vector backbone: pGEX-6-P1
• Backbone manufacturer: Amersham
• Backbone size (bp): 5000
• Modifications to backbone: RfB Gateway cassette cloned into SmaI site to generate pGEX6P1-DEST. HA tag cloned into XhoI site of pGEX6P1-DEST, XhoI site only intact on 3' end
• Vector type: Bacterial Expression
• Promoter: tac promoter
• Tags / Fusion Proteins:
  • GST (N terminal on insert)
  • HA (C terminal on insert)

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Growth instructions: Ideally grow with Ampicillin and Chloramphenicol in growth medium
• Copy number: High Copy

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: PGEX5' - GGGCTGGCAAGCCACGTTTGGTG
• 3′ sequencing primer: PGEX3' - CCGGGAGCTGCATGTGTCAGAGG

Resource Information

• Supplemental Documents:
  • pGEX6P1-DEST-HA.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry