Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGEX6P1-DEST-HA
(Plasmid #119751)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119751 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGEX-6-P1
  • Backbone manufacturer
    Amersham
  • Backbone size (bp) 5000
  • Modifications to backbone
    RfB Gateway cassette cloned into SmaI site to generate pGEX6P1-DEST. HA tag cloned into XhoI site of pGEX6P1-DEST, XhoI site only intact on 3' end
  • Vector type
    Bacterial Expression
  • Promoter tac promoter
  • Tags / Fusion Proteins
    • GST (N terminal on insert)
    • HA (C terminal on insert)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Growth instructions
    Ideally grow with Ampicillin and Chloramphenicol in growth medium
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer PGEX5' - GGGCTGGCAAGCCACGTTTGGTG
  • 3′ sequencing primer PGEX3' - CCGGGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX6P1-DEST-HA was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 119751 ; http://n2t.net/addgene:119751 ; RRID:Addgene_119751)