pGEX6P1-DEST
(Plasmid #119749)

• Purpose: (Empty Backbone) Allows Gateway cloning of gene of interest into bacterial expression vector with PreScission Protease cleavable N-terminal GST tag.
• Depositing Labs: Andrew Jackson, Martin Reijns
• Publication: Bacterial expression plasmids for production of recombinant proteins with a PreScission Protease cleavable GST tag and additional small affinity tags (unpublished)

Backbone

• Vector backbone: pGEX-6-P1
• Backbone manufacturer: Amersham
• Backbone size (bp): 5000
• Modifications to backbone: RfB Gateway cassette cloned into pGEX6P1 SmaI site
• Vector type: Bacterial Expression
• Promoter: tac promoter
• Tag / Fusion Protein:
  • GST (N terminal on insert)

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Growth instructions: Ideally grow with Ampicillin and Chloramphenicol in growth medium
• Copy number: High Copy

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: PGEX5' - GGGCTGGCAAGCCACGTTTGGTG
• 3′ sequencing primer: PGEX3' - CCGGGAGCTGCATGTGTCAGAGG

Resource Information

• Supplemental Documents:
  • pGEX6P1-DEST.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry