pAL950
(Plasmid #119748)

• Purpose: precursor outer membrane pore protein E, phoE with mutations Alanine 249 to Cysteine and Glutamine 307 to Cysteine
• Depositing Lab: Linda Randall
• Publication: Bariya et al J Bacteriol. 2018 Oct 1. pii: JB.00493-18. doi: 10.1128/JB.00493-18.

Backbone

• Vector backbone: pET11a
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5677
• Total vector size (bp): 6708
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): BL21.19
• Growth instructions: Change media and shift temperature to 39 degrees with IPTG added to produce the precursor proteins
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: precusor Outer membrane pore protein E, phoE, with mutations Alanine 249 to Cysteine and Glutamine 307 to Cysteine
• Alt name: ECK0242, JW0231, ompE
• Species: Escherichia coli (strain K12)
• Insert Size (bp): 1072
• Mutation: Internal NdeI site removed and mutations Alanine 249 to Cysteine and Glutamine 307 to Cysteine
• GenBank ID: V00316.1
• Promoter: T7
• Tag / Fusion Protein:
  • none

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: 5' - ACTTTGGCGGCAGCGATTTC - 3'
• 3′ sequencing primer: 5' - CCTTTCGGGCTTTGTTAG - 3'

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Hans de Cock at University of Utrecht, The NETHERLANDS

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Vector contains T7 promoter, lacI coding sequence, pBR322 origin

Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at or contact our distributors if you have any questions.