pMSCVhyg-DEST
(Plasmid
#119747)
-
Purpose(Empty Backbone) Allows Gateway cloning of gene of interest into retroviral pMSCV vector (with Hygromycin resistance)
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 119747 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMSCVhyg
-
Backbone manufacturerClontech
- Backbone size (bp) 7000
-
Modifications to backboneRfB Gateway cassette cloned into pMSCVhyg HpaI site
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer pMSCV-5' - CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer pMSCV-3' - GAGACGTGCTACTTCCATTTGTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCVhyg-DEST was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 119747 ; http://n2t.net/addgene:119747 ; RRID:Addgene_119747)