pAAV_hsyn_NES-his-CaMPARI2-F391W-L398V
(Plasmid #119723)

• Purpose: AAV vector expressing CaMPARI2_F391W-L398V (Kd = 174nM), a photoconvertible fluorescent protein-based calcium integrator, in neurons
• Depositing Lab: Thomas Oertner
• Publication: Moeyaert et al Nat Commun. 2018 Oct 25;9(1):4440. doi: 10.1038/s41467-018-06935-2.

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 4267
• Total vector size (bp): 5575
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: CaMPARI2
• Species: Synthetic
• Insert Size (bp): 1308
• Mutation: F391W, L398V
• Promoter: hSyn1
• Tag / Fusion Protein:
  • NES-his (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: syn-sense2 GACTCAGCGCTGCCTCAGTCTG
• 3′ sequencing primer: P5E gtaatccagaggttgattatcg

Gene/Insert 2

• Gene/Insert name: CaMPARI2
• Species: Synthetic
• Insert Size (bp): 1308

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: syn-sense2 GACTCAGCGCTGCCTCAGTCTG
• 3′ sequencing primer: P5E gtaatccagaggttgattatcg

Resource Information

• Supplemental Documents:
  • pAAV_hsyn_NES-his-CaMPARI2-F391W-L398V_(no tags).gb
• A portion of this plasmid was derived from a plasmid made by: CaMPARI 2.0 was a kind gift of Eric Schreiter Lab (Janelia Farm)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry