FB027
(Plasmid
#119712)
-
PurposeMultipartite assembly obtained by combining FB parts FB026+FB003 into pDGB3omega1. Used for fluorescent tagging of fungi (Hyg resistance +YFP) according to FungalBraid modular DNA assembly for ATMT
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 119712 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePDGB3omega1
-
Backbone manufacturerDiego Orzaez
- Backbone size w/o insert (bp) 7295
- Total vector size (bp) 10106
-
Vector typeSynthetic Biology
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePgpdA::YFP::TtrpC(←)-PtrpC::hph::Ttub (→)
-
Alt nameFB026+FB003
-
Insert Size (bp)3392
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmB1 (destroyed during cloning)
- 3′ cloning site BsmB1 (destroyed during cloning)
- 5′ sequencing primer CGAGTGGTGATTTTGTGCCG
- 3′ sequencing primer CCCGCCAATATATCCTGTCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FB027 was a gift from Jose Marcos (Addgene plasmid # 119712 ; http://n2t.net/addgene:119712 ; RRID:Addgene_119712) -
For your References section:
FungalBraid: A GoldenBraid-based modular cloning platform for the assembly and exchange of DNA elements tailored to fungal synthetic biology. Hernanz-Koers M, Gandia M, Garrigues S, Manzanares P, Yenush L, Orzaez D, Marcos JF. Fungal Genet Biol. 2018 Jul;116:51-61. doi: 10.1016/j.fgb.2018.04.010. Epub 2018 Apr 20. 10.1016/j.fgb.2018.04.010 PubMed 29680684