Skip to main content
Addgene

FB003
(Plasmid #119677)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119677 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PDGB3alpha2 (Addgene #68214)
  • Backbone manufacturer
    Diego Orzaez
  • Backbone size w/o insert (bp) 6967
  • Total vector size (bp) 8026
  • Vector type
    Synthetic Biology
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PtrpC:hph:Ttub
  • Alt name
    Hygromicin resistance cassette
  • Species
    Ptrpc (A. nidulans): hph (E. coli): Ttub (N. crassa)
  • Insert Size (bp)
    1666

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer CGAGTGGTGATTTTGTGCCG
  • 3′ sequencing primer CCCGCCAATATATCCTGTCAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FB003 was a gift from Jose Marcos (Addgene plasmid # 119677 ; http://n2t.net/addgene:119677 ; RRID:Addgene_119677)
  • For your References section:

    FungalBraid: A GoldenBraid-based modular cloning platform for the assembly and exchange of DNA elements tailored to fungal synthetic biology. Hernanz-Koers M, Gandia M, Garrigues S, Manzanares P, Yenush L, Orzaez D, Marcos JF. Fungal Genet Biol. 2018 Jul;116:51-61. doi: 10.1016/j.fgb.2018.04.010. Epub 2018 Apr 20. 10.1016/j.fgb.2018.04.010 PubMed 29680684
Commonly requested with: