FB003
(Plasmid
#119677)
-
PurposeTranscriptional Unit (TU) for hygromicin resistance in fungi obtained by combining FB001+GB0211+FB002 into pDGB3alpha2. According to FungalBraid/GoldenBraid modular DNA assembly for ATMT
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 119677 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePDGB3alpha2 (Addgene #68214)
-
Backbone manufacturerDiego Orzaez
- Backbone size w/o insert (bp) 6967
- Total vector size (bp) 8026
-
Vector typeSynthetic Biology
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePtrpC:hph:Ttub
-
Alt nameHygromicin resistance cassette
-
SpeciesPtrpc (A. nidulans): hph (E. coli): Ttub (N. crassa)
-
Insert Size (bp)1666
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer CGAGTGGTGATTTTGTGCCG
- 3′ sequencing primer CCCGCCAATATATCCTGTCAAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FB003 was a gift from Jose Marcos (Addgene plasmid # 119677 ; http://n2t.net/addgene:119677 ; RRID:Addgene_119677) -
For your References section:
FungalBraid: A GoldenBraid-based modular cloning platform for the assembly and exchange of DNA elements tailored to fungal synthetic biology. Hernanz-Koers M, Gandia M, Garrigues S, Manzanares P, Yenush L, Orzaez D, Marcos JF. Fungal Genet Biol. 2018 Jul;116:51-61. doi: 10.1016/j.fgb.2018.04.010. Epub 2018 Apr 20. 10.1016/j.fgb.2018.04.010 PubMed 29680684