pC0.282
(Plasmid
#119648)
-
PurposeLevel 0 Part. Insertion site
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 119648 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepICH41295
- Backbone size w/o insert (bp) 2247
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name7002 NS2 DOWN Flank
-
Insert Size (bp)1000
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer ttgagtgagctgataccgct
- 3′ sequencing primer GTCTCATGAGCGGATACATATTTGAATG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Synechoccoccus sp. PCC 7002, upstream sequence for A0159. Please visit https://www.biorxiv.org/content/10.1101/426700v1 for bioRxiv preprint.
Addgene NGS identified a single nucleotide discrepancy in the 7002 NS2 DOWN Flank, relative to the sequence provided by the depositing laboratory. The depositing laboratory has indicated that this discrepancy will likely not affect function. See Genbank file for details.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC0.282 was a gift from Alistair McCormick (Addgene plasmid # 119648 ; http://n2t.net/addgene:119648 ; RRID:Addgene_119648) -
For your References section:
CyanoGate: A Modular Cloning Suite for Engineering Cyanobacteria Based on the Plant MoClo Syntax. Vasudevan R, Gale GAR, Schiavon AA, Puzorjov A, Malin J, Gillespie MD, Vavitsas K, Zulkower V, Wang B, Howe CJ, Lea-Smith DJ, McCormick AJ. Plant Physiol. 2019 May;180(1):39-55. doi: 10.1104/pp.18.01401. Epub 2019 Feb 28. 10.1104/pp.18.01401 PubMed 30819783