pYES2-Ub-M-GFP
(Plasmid #11952)

• Depositing Lab: Nico Dantuma
• Publication: Heessen et al FEBS Lett. 2003 Dec 4. 555(2):397-404.

Backbone

• Vector backbone: pYES2
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5830
• Vector type: Yeast Expression
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Ub-M-GFP
• Alt name: Ubiquitin
• Alt name: Ub
• Insert Size (bp): 998
• Mutation: Ubiquitin fused to N-terminus of GFP. Methionine at position 1 between Ub and GFP (see article 10802622). Stable version.

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: GAL1 primer

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The ubiquitin open reading frame was amplified by PCR from the Ub-Pro-Gal plasmid with the sense primer 5'-GCG GAATTCACCATGCAGATCTTCGTGAAGACT-3' and the antisense primer 5'-GCG GGATCCTGTCGACCAAGCTTCCCXXX CCCACCTCTGAGACGGAGTAC-3' where the XXX leads to a Methionine at position 1 (see article 10802622, Figure 1). The PCR product was cloned into the EcoRI and BamHI sites of the EGFP-N1 vector from Clontech.

The Ub-M-GFP insert was then excised with EcoRI and NotI and cloned into pYES2.