Ub-R-YFP
(Plasmid #11948)

• Depositing Lab: Nico Dantuma
• Publication: Menendez-Benito et al Hum Mol Genet. 2005 Oct 1. 14(19):2787-99.

Backbone

• Vector backbone: EGFP-N1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 3970
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Ub-R-YFP
• Alt name: Ubiquitin
• Alt name: Ub
• Insert Size (bp): 990
• Mutation: Ubiquitin fused to N-terminus of YFP. Arginine at position 1 between Ub and YFP (see article 10802622). N-end rule degradation signal.

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CMV-F

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The ubiquitin open reading frame was amplified by PCR from the Ub-Pro-Gal plasmid with the sense primer 5'-GCG GAATTCACCATGCAGATCTTCGTGAAGACT-3' and the antisense primer 5'-GCG GGATCCTGTCGACCAAGCTTCCCXXX
CCCACCTCTGAGACGGAGTAC-3' where the XXX leads to an arginine at position 1 (see article 10802622, Figure 1). The PCR product was cloned into the EcoRI and BamHI sites of the EGFP-N1 vector from Clontech.

Subsequently, the GFP open reading frame was replaced with a YFP open reading frame using the PinAI and NotI restriction sites.