GFP-Ub KO
(Plasmid #11934)

• Depositing Lab: Nico Dantuma
• Publication: Bergink et al Genes Dev. 2006 May 15. 20(10):1343-52.

Backbone

• Vector backbone: EGFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4731
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Ubiquitin KO
• Alt name: Ubiquitin
• Alt name: Ub
• Species: H. sapiens (human)
• Insert Size (bp): 245
• Mutation: All 7 lysines of ubiquitin mutated to arginines.
• Entrez Gene: RBX1 (a.k.a. BA554C12.1, RNF75, ROC1)
• Tag / Fusion Protein:
  • GFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: EGFP-C (CATGGTCCTGCTGGAGTTCGTG)

Resource Information

• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry