Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

GFP-Ub KO
(Plasmid #11934)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 11934 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    EGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4731
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ubiquitin KO
  • Alt name
    Ubiquitin
  • Alt name
    Ub
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    245
  • Mutation
    All 7 lysines of ubiquitin mutated to arginines.
  • Entrez Gene
    RBX1 (a.k.a. BA554C12.1, RNF75, ROC1)
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer EGFP-C (CATGGTCCTGCTGGAGTTCGTG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-Ub KO was a gift from Nico Dantuma (Addgene plasmid # 11934 ; http://n2t.net/addgene:11934 ; RRID:Addgene_11934)
  • For your References section:

    DNA damage triggers nucleotide excision repair-dependent monoubiquitylation of histone H2A. Bergink S, Salomons FA, Hoogstraten D, Groothuis TA, de Waard H, Wu J, Yuan L, Citterio E, Houtsmuller AB, Neefjes J, Hoeijmakers JH, Vermeulen W, Dantuma NP. Genes Dev. 2006 May 15. 20(10):1343-52. 10.1101/gad.373706 PubMed 16702407