PAGFP-Ub
(Plasmid #11933)

• Depositing Lab: Nico Dantuma
• Publication: Dantuma et al J Cell Biol. 2006 Apr 10. 173(1):19-26.

Backbone

• Vector backbone: EGFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4500
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Ubiquitin
• Alt name: Ub
• Alt name: ubiquitin
• Species: H. sapiens (human)
• Insert Size (bp): 250
• Entrez Gene: RBX1 (a.k.a. BA554C12.1, RNF75, ROC1)
• Tag / Fusion Protein:
  • PAGFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: EGFP-C (CATGGTCCTGCTGGAGTTCGTG)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: PAGFP-C1 was a gift from Jennifer Lippincott-Scwartz.
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

PAGFP is a photoactivatable version of GFP. It is essentially the same as the standard EGFP-C1 from clontech, but contains the mutations L64F/T65S/V163A/T203H, and conatins an A206K mutation to disrupt dimerization.

In total, the PAGFP-Ubiquitin insert is 983bp.