Skip to main content
Addgene

pAL800
(Plasmid #119306)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119306 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET503
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    BL21.19
  • Growth instructions
    lysogen lambda DE3 not required Change media and shift temperature to 39 degrees with IPTG added to produce the precursor proteins
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    precusor outer membrane protein A, ompA, with amino acids 1 through 171 deleted and mutations G244C and C290S
  • Alt name
    OmpA, con, tolG, tut
  • Species
    Escherichia coli (strain K12)
  • Insert Size (bp)
    525
  • Mutation
    amino acids 1 through 171 deleted, and mutatioms Glycine 244 to Cysteine and Cysteine 290 to Serine
  • GenBank ID
    945571
  • Promoter lac
  • Tag / Fusion Protein
    • none

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer unknown
  • 3′ sequencing primer 5' - CACGGCGCTCGGACAGACCC - 3'
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Arnold Driessen at University of Groningen in the Neatherlands

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAL800 was a gift from Linda Randall (Addgene plasmid # 119306 ; http://n2t.net/addgene:119306 ; RRID:Addgene_119306)
  • For your References section:

    Co-assembly of SecYEG and SecA fully restores the properties of the native translocon. Bariya P, Randall LL. J Bacteriol. 2018 Oct 1. pii: JB.00493-18. doi: 10.1128/JB.00493-18. 10.1128/JB.00493-18 PubMed 30275279