pAL800
(Plasmid #119306)

• Purpose: precusor outer membrane protein A, ompA, with amino acids 1 through 171 deleted and mutations G244C and C290S
• Depositing Lab: Linda Randall
• Publication: Bariya et al J Bacteriol. 2018 Oct 1. pii: JB.00493-18. doi: 10.1128/JB.00493-18.

Backbone

• Vector backbone: pET503
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): BL21.19
• Growth instructions: lysogen lambda DE3 not required Change media and shift temperature to 39 degrees with IPTG added to produce the precursor proteins
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: precusor outer membrane protein A, ompA, with amino acids 1 through 171 deleted and mutations G244C and C290S
• Alt name: OmpA, con, tolG, tut
• Species: Escherichia coli (strain K12)
• Insert Size (bp): 525
• Mutation: amino acids 1 through 171 deleted, and mutatioms Glycine 244 to Cysteine and Cysteine 290 to Serine
• GenBank ID: 945571
• Promoter: lac
• Tag / Fusion Protein:
  • none

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: unknown
• 3′ sequencing primer: 5' - CACGGCGCTCGGACAGACCC - 3'

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Arnold Driessen at University of Groningen in the Neatherlands

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at or contact our distributors if you have any questions.