nLuc_AP10_PPVs_P9mS
(Plasmid
#119302)
-
PurposeExpresses N-terminus of split luciferase fused to antiparallel coiled-coil AP10 connected with autoinhibitory coil P9mS and PPVs cleavage site in antiparallel harpin linker/for SPOC logic
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 119302 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3
- Backbone size w/o insert (bp) 5443
- Total vector size (bp) 7249
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesplit nLuc fused to antiparallel Coiled-coil AP10 connected with P9mS via PPV cleavable linker
-
Alt namenLuc_AP10_PPVs_P9mS
-
Insert Size (bp)1806
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
nLuc_AP10_PPVs_P9mS was a gift from Roman Jerala (Addgene plasmid # 119302 ; http://n2t.net/addgene:119302 ; RRID:Addgene_119302) -
For your References section:
Design of fast proteolysis-based signaling and logic circuits in mammalian cells. Fink T, Lonzaric J, Praznik A, Plaper T, Merljak E, Leben K, Jerala N, Lebar T, Strmsek Z, Lapenta F, Bencina M, Jerala R. Nat Chem Biol. 2019 Feb;15(2):115-122. doi: 10.1038/s41589-018-0181-6. Epub 2018 Dec 10. 10.1038/s41589-018-0181-6 PubMed 30531965