GFP-Ub
(Plasmid #11928)

• Purpose: Used for in vivo monitoring of ubiquitin localization.
• Depositing Lab: Nico Dantuma
• Publication: Dantuma et al J Cell Biol. 2006 Apr 10. 173(1):19-26.

Backbone

• Vector backbone: EGFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4731
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Ubiquitin
• Alt name: Ub
• Alt name: ubiquitin C
• Alt name: UBC
• Species: H. sapiens (human)
• Insert Size (bp): 245
• GenBank ID: NM_021009
• Entrez Gene: UBC (a.k.a. HMG20)
• Tag / Fusion Protein:
  • GFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: EGFP-C (CATGGTCCTGCTGGAGTTCGTG)

Resource Information

• Articles Citing this Plasmid:
  • 40 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry