pFUGW-GtACR1_C102A-EYFP
(Plasmid #119196)

• Purpose: Step-function mutant of Guillardia theta anion channelrhodopsin 1 (GtACR1) with dramatically prolonged open state
• Depositing Lab: John Spudich
• Publication: Govorunova et al eNeuro. 2018 Jul 10;5(3). pii: eN-MNT-0174-18. doi: 10.1523/ENEURO.0174-18.2018. eCollection 2018 May-Jun.

Backbone

• Vector backbone: pFUGW
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Anion channelrhodopsin GtACR1 step-function mutant C102A
• Species: Guillardia theta
• Insert Size (bp): 885
• Mutation: changed cysteine 102 to alanine
• GenBank ID: KP171708 KP171708
• Promoter: Ubiquitin
• Tag / Fusion Protein:
  • EYFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ATGCGCTCGGGGTTGGCGAGTGTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry