pFUGW-RapACR_T111C-EYFP
(Plasmid #119195)

• Purpose: Fast anion channelrhodopsin mutant RapACR_T111C for time-resolved inhibition of neuronal spiking
• Depositing Lab: John Spudich
• Publication: Govorunova et al eNeuro. 2018 Jul 10;5(3). pii: eN-MNT-0174-18. doi: 10.1523/ENEURO.0174-18.2018. eCollection 2018 May-Jun.

Backbone

• Vector backbone: pFUGW
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Anion channelrhodopsin RapACR fast mutant T111C
• Species: Rhodomonas salina
• Insert Size (bp): 921
• Mutation: changed threonine 111 to cysteine
• GenBank ID: MG831192
• Promoter: Ubiquitin
• Tag / Fusion Protein:
  • EYFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ATGCGCTCGGGGTTGGCGAGTGTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry