Desmoplakin I acceptor only control (F40-based tension sensor)
(Plasmid #119189)

• Purpose: The acceptor (mEYFP) only control for the F40-based human desmoplakin I tension sensor can be used for bleedthrough calibration or with the donor only control to determine intermolecular FRET.
• Depositing Lab: Alex Dunn
• Publication: Price et al Nat Commun. 2018 Dec 11;9(1):5284. doi: 10.1038/s41467-018-07523-0.

Backbone

• Vector backbone: pSBtet-Pur
• Backbone manufacturer: Eric Kowarz
• Backbone size w/o insert (bp): 5569
• Total vector size (bp): 16228
• Vector type: Mammalian Expression ; Transposon
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: human Desmoplakin I-[mTFP1(Y72G)-F40-mEYFP] (internal-1945)
• Alt name: Desmoplakin I acceptor only control (F40-based tension sensor)
• Species: H. sapiens (human)
• Insert Size (bp): 10659
• Mutation: inserted F40-based tension sensor module after aa1945; Y72G in mTFP1 to disrupt chromophore formation
• GenBank ID: NM_004415.3
• Entrez Gene: DSP (a.k.a. DCWHKTA, DP)
• Promoter: TCE
• Tag / Fusion Protein:
  • mTFP1-F40-mEYFP

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SfiI (not destroyed)
• 3′ cloning site: SfiI (not destroyed)
• 5′ sequencing primer: CCTGGAGCCAATTCCAACTCT
• 3′ sequencing primer: CACTGCATTCTTGTTGTGGTT

Resource Information

• Supplemental Documents:
  • SBtet-Pur_DPI-TSdTFP.gb
• A portion of this plasmid was derived from a plasmid made by: Desmoplakin I-GFP (Addgene, #32227) from Kathleen Green used as a template for Desmoplakin I and pSBtet-Pur (Addgene plasmid #60507) from Eric Kowarz used as a backbone.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry