pAAV-HyPer-DAAO-NES
(Plasmid #119164)

• Purpose: Fusion of hydrogen peroxide fluorescent biosensor HyPer and D-amino acid oxidase; excluded from nucleus. Allows H2O2 production/detection by adding D-amino acids. AAV expression vector; CMV promoter.
• Depositing Lab: Thomas Michel
• Publication: Steinhorn et al Nat Commun. 2018 Oct 2;9(1):4044. doi: 10.1038/s41467-018-06533-2.

Backbone

• Vector backbone: pAAV-MCS
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 4600
• Total vector size (bp): 7200
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HyPer-DAAO-NES
• Alt name: D-amino Acid Oxidase
• Species: R. gracilis
• Insert Size (bp): 2571
• Promoter: CMV
• Tag / Fusion Protein:
  • NES (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ACTTTGGCAAAGAATTGGGATTCGAAC
• 3′ sequencing primer: GTCACAGGGATGCCACCCG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: DAAO component of fusion protein received from Vsevolod Belousov, who's lab originally cloned DAAO.
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry