Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pColE1_sgRNA_M7NS_AmpR
(Plasmid #119157)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119157 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    YTK095
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with seven mismatches in the non-seed region
  • Alt name
    sgRNA-M7NS
  • gRNA/shRNA sequence
    CCATTTTTTGTCAACACGCA
  • Promoter J23119

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NsiI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ttatagtcctgtcgggtttcg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Dr. Chase Beisel Lab

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pColE1_sgRNA_M7NS_AmpR was a gift from Vincent Noireaux (Addgene plasmid # 119157 ; http://n2t.net/addgene:119157 ; RRID:Addgene_119157)
  • For your References section:

    An educational module to explore CRISPR technologies with a cell-free transcription-translation system. Collias D, Marshall R, Collins SP, Beisel CL, Noireaux V. Synth Biol (Oxf). 2019 Jan 21;4(1):ysz005. doi: 10.1093/synbio/ysz005. eCollection 2019. 10.1093/synbio/ysz005 PubMed 32995532