pColE1_sgRNA_pos5_AmpR
(Plasmid
#119148)
-
PurposeEncodes sgRNA targeting position 5 in pColE1_70a_deGFP_KanR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 119148 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneYTK095
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA targeting position 5 in pColE1_70a_deGFP_KanR
-
Alt namesgRNA-pos5
-
gRNA/shRNA sequenceTGTTAGCTCAGCATGCCCAG
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. Chase Beisel Lab
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Marshall et al. 2018 (PMID: 29304331)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pColE1_sgRNA_pos5_AmpR was a gift from Vincent Noireaux (Addgene plasmid # 119148 ; http://n2t.net/addgene:119148 ; RRID:Addgene_119148) -
For your References section:
An educational module to explore CRISPR technologies with a cell-free transcription-translation system. Collias D, Marshall R, Collins SP, Beisel CL, Noireaux V. Synth Biol (Oxf). 2019 Jan 21;4(1):ysz005. doi: 10.1093/synbio/ysz005. eCollection 2019. 10.1093/synbio/ysz005 PubMed 32995532